View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_81 (Length: 247)
Name: NF20094_low_81
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_81 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 81 - 236
Target Start/End: Original strand, 31279058 - 31279213
Alignment:
| Q |
81 |
atgcatcaagaacattatgaacatcaagaaaacattcttcctgtcaaaataaaatgaaatcaccagaattgttgtcttttcaaataaaccatgacaagtt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31279058 |
atgcatcaagaacattatgaacatcaagaaaacattcttcctgtcaaaataaaatgaaatcaccagaattgctgtcttttcaaataaaccatgacaagtt |
31279157 |
T |
|
| Q |
181 |
tcagaaagcaaaaccaagataaaaatatgaattttaatcaccaaaaataagatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31279158 |
tcagaaagcaaaaccaagataaaaatatgatttttaatcaccaaaaataagatatt |
31279213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University