View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_86 (Length: 241)
Name: NF20094_low_86
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 21 - 224
Target Start/End: Original strand, 31605191 - 31605394
Alignment:
| Q |
21 |
ggagttttcagttatgggtaattagttagctggttagacnnnnnnnnaagaagaataactagttgctggaattgacataagaaggaattgaatctgaagt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||| ||| ||||| | |
|
|
| T |
31605191 |
ggagttttcagttatgggtaattagttagctggttagacttttttttaagaagacaaactagttgctggaattgacataagaatgaatcgaacctgaaat |
31605290 |
T |
 |
| Q |
121 |
tttaaaagaaatacattctaaaatcttaaatcaacgcattctaagttatagttgttacttgttagttaggctaattacaatcgatttcattttggttata |
220 |
Q |
| |
|
|||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||| ||||| |
|
|
| T |
31605291 |
tttaaaaggaatacattccaaaatctcaaatcaacgcattctaagttatagttgttacttgttagttagactaattatagtcgatttcattttgattata |
31605390 |
T |
 |
| Q |
221 |
taag |
224 |
Q |
| |
|
|||| |
|
|
| T |
31605391 |
taag |
31605394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University