View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20094_low_94 (Length: 237)
Name: NF20094_low_94
Description: NF20094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20094_low_94 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 79 - 237
Target Start/End: Original strand, 33739694 - 33739853
Alignment:
| Q |
79 |
cacaaacagtggcaacgcaaagagaaggacttgcactcgtggattgtttcagtcagccaacttg-gcactcacgtgctttgattttgcaagacatgatga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33739694 |
cacaaacagtggcaacgcaaagagaaggacttgcactcgtggattgtttcagtcagccaacttgtgcactcacgtgctttgattttgcaagatatgatga |
33739793 |
T |
 |
| Q |
178 |
tgccaagtcgcatcgtgcaactcgtttttaactcacgtttcgtcctgaatgattctcttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33739794 |
tgccaagtcgcatcgtgcaactcgtttttaactcacgtttcgtcctgaatgattctcttc |
33739853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 33739635 - 33739674
Alignment:
| Q |
17 |
atgtgaacgtgtcataattggttttgtaatctgctttgcc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33739635 |
atgtgaacgtgtcataattggttttgtaatctgctttgcc |
33739674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University