View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20095_high_3 (Length: 272)
Name: NF20095_high_3
Description: NF20095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20095_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 12 - 170
Target Start/End: Complemental strand, 40514166 - 40514014
Alignment:
| Q |
12 |
atactataattttcaagaaacggactctaatttttcgaggaccattccatgcccacacacaaatcaaagagatgatcaatgttgttagtgttaggaggag |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514166 |
atactataattttcaagaaatggactct------tcgaggaccattccatgcccacacacaaatcaaagagatgatcaatgttgttagtgttaggaggag |
40514073 |
T |
 |
| Q |
112 |
tttgagaaaggaactcataaacaatagtatgtgcttcatatttcaaccaccgtagtaaa |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514072 |
tttgggaaaggaactcataaacaatagtatgtgcttcatatttcaaccaccgtagtaaa |
40514014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 214
Target Start/End: Complemental strand, 40512859 - 40512831
Alignment:
| Q |
186 |
gccaattgcaacacttaatcttctccagg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40512859 |
gccaattgcaacacttaatcttctccagg |
40512831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University