View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20095_low_5 (Length: 251)
Name: NF20095_low_5
Description: NF20095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20095_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 5 - 232
Target Start/End: Original strand, 44004158 - 44004390
Alignment:
| Q |
5 |
actgacggtggttagacacaagcctgagcccatggcatacatcatgtgaggaccagggcctggaatggcataaat-----aatcactttcaactatcagc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
44004158 |
actgacggtggttagacacaagcctgagcccatggcatacatcatgtgaggaccagggcctggcatggcataaataaaataatcactttcaactttcagc |
44004257 |
T |
 |
| Q |
100 |
ttcaacaaacaatcaaagttcctacacacaacagagtcaagatcctctcagtctcaactgcctttgaagatagataacaaactgtgctgtatgtggcagt |
199 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44004258 |
ttcaacaaacaatataagttccttcactcaacagagtcaagatcctctcagtctcaactgcctttgaagatagataactaactgtgctgtatgtggcagt |
44004357 |
T |
 |
| Q |
200 |
cttaaaaaggtaaagttagtgcgggaaatgtgt |
232 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
44004358 |
cttaaaaaggtaaagttagtgcgggtaatgtgt |
44004390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University