View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20099_high_33 (Length: 247)
Name: NF20099_high_33
Description: NF20099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20099_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 9462359 - 9462400
Alignment:
| Q |
1 |
tatggctcgctaagcgatcatttctgttatgacaagcaaggt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462359 |
tatggctcgctaagcgatcatttctgttatgacaagcaaggt |
9462400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University