View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20099_high_38 (Length: 228)
Name: NF20099_high_38
Description: NF20099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20099_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 41242461 - 41242670
Alignment:
| Q |
1 |
ctgtaaattatgttattgaaatgtcttattgcatgtttggaacagctttgcgtccaatttctcacgtcctaaagcatagtagtggccttaacgtgagttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
41242461 |
ctgtaaattatgttattgaaatgtcttattgcatgtttggaacagctttgcgtccaatttctcgcatcctaaagcatagtagtggccttaacgtgagttt |
41242560 |
T |
 |
| Q |
101 |
gctttgatttcaacatgaaaacaaacagccgcttagagatacaccgaagcaagtatggggacgaaatcagaacttaatgataaagattggtcacatcaca |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41242561 |
gctttgatttcaacgtgaaaacaaacagccgcttagaagtacaccgaagcaagtatggggacgaaatcagaacttaatgataaagattggtcacatcaca |
41242660 |
T |
 |
| Q |
201 |
atcggtcaac |
210 |
Q |
| |
|
||| |||||| |
|
|
| T |
41242661 |
atcagtcaac |
41242670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University