View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20099_low_18 (Length: 339)
Name: NF20099_low_18
Description: NF20099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20099_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 117 - 320
Target Start/End: Complemental strand, 26949017 - 26948815
Alignment:
| Q |
117 |
ataaatatcattaaatgggtgtaattgtcaagctatgaatatttttctattagtgtaatggtcaagctatgagtatttttattattctagtcactaagag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26949017 |
ataaatatcattaaatgggtgtaattgtcaagctatgaatatttttctattagtgtaatggtcaagctatgagtatttttattattctagtcactaagag |
26948918 |
T |
|
| Q |
217 |
taagtttttcattaattaaaaacattccaaattttggtaatgcaatatgtgtaagttcttaccgaaaacaagtcaaaactagcatatatgttttggaaca |
316 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26948917 |
taagtttttcattaatt-aaaacattccaaattttggtaatgcaatatgtgtaagttcttaccgaaaacaagtcaaaactagcatatatgttttggaaca |
26948819 |
T |
|
| Q |
317 |
taat |
320 |
Q |
| |
|
|||| |
|
|
| T |
26948818 |
taat |
26948815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University