View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20099_low_19 (Length: 337)
Name: NF20099_low_19
Description: NF20099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20099_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 10 - 326
Target Start/End: Complemental strand, 32781250 - 32780925
Alignment:
| Q |
10 |
tcatcagaaacaaatattagagaaatagtggcttcagtaacaagtgtccaagaaagttgcagc---tgctttgattgttgttg------ttttggtatgt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||| | ||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||||| |
|
|
| T |
32781250 |
tcatcagtaacaaatattagagaaatagtgacatcagtaacatgtttccaagaaagttgctgcaactgctatgattgttgttgctgttgttttggtatgt |
32781151 |
T |
|
| Q |
101 |
ccttcatggaagaagtcttcaaatatatctggnnnnnnnattcttttgcaaataaaaaacagatcaagctcattgcctggatatatttgatcaaaatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
32781150 |
ccttcatggaagaagtcttcaaatatatctggtttttttattcttttgcaaatcaaaaacagatcaagctcattgcctggatatatttgatcaaagtgtt |
32781051 |
T |
|
| Q |
201 |
tatctttgaactagcaatgtttcaccctctagcattctcattgtttattggtgtaccaagataatctaaagtttgcagcattgtttatatagcatgccta |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32781050 |
tgtctttgaactagcaatgtttcaccctctagcagtctcattgtttattggtgtaccaagataatctaaagtttgcaacattgtttatatagcatgccta |
32780951 |
T |
|
| Q |
301 |
tttaatgtcgatttgtattggttcat |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32780950 |
tttaatgtcgatttgtattggttcat |
32780925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University