View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20099_low_23 (Length: 326)
Name: NF20099_low_23
Description: NF20099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20099_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 324
Target Start/End: Original strand, 33445726 - 33446028
Alignment:
| Q |
22 |
aaaccgatatgttgaggcagtttgcagattggattttatctattggtgatgggaagattggtgatttggttgacggtgactgcgtagttgatattcctca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||| | ||| |||||||||||||| |
|
|
| T |
33445726 |
aaaccgatatgttgaggcagtttgcagattggattttatccattggtgatgggaagattggtgaagcgcgtgacggtgaattcgtggttgatattcctca |
33445825 |
T |
 |
| Q |
122 |
tgatcttttggttgaaaattctggtgatccgatcaatgacattgtttcttcaacgtatcctaatttggtggataatttgtctgatgaaaagtttttccat |
221 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |||||| ||||||||| |||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
33445826 |
tgatcttttgcttgaaaattctggcgatccgatcaatgatattgttcgttcaacgtaccctaatttggtgaataatttgtctcatgaaaactttttccat |
33445925 |
T |
 |
| Q |
222 |
gatcgtacaattcttgcacccactcttgagttggtcgagaaggttaatgactacatcatgactatgggtcctggagaagagaaggaatatttgagctgtg |
321 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
33445926 |
gatcgtgcaattcttgtgcccactcttgagttggtcgagaaggttaacgactacatcatggtcatgcttcctggagatgagaaggaatatttgagctgtg |
33446025 |
T |
 |
| Q |
322 |
att |
324 |
Q |
| |
|
||| |
|
|
| T |
33446026 |
att |
33446028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University