View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20099_low_30 (Length: 294)
Name: NF20099_low_30
Description: NF20099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20099_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 20 - 284
Target Start/End: Complemental strand, 44715281 - 44715017
Alignment:
| Q |
20 |
aatcgagactaggaagaatgactgaaatccacgcgccgtataaaatagcgaaaggaaaaacgtctaagcgccatggcaattgcttcttccggagtagatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715281 |
aatcgagactaggaagaatgactgaaatccacgcgccgtataaaatagcgaaaggaaaaacgtctaagcgccatggcaattgcttcttccggagtagatc |
44715182 |
T |
 |
| Q |
120 |
aactttgtctacgaccttaccgccgacgtgaaaagtcgacattaatcgcttattttgataatcgattaagagtggtgattagggtttgtagatctggttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715181 |
aactttgtctacgaccttaccgccgacgtgaaaagtcgacattaatcgcttattttgataatcgattaagagtggtgattagggtttgtagatctggttg |
44715082 |
T |
 |
| Q |
220 |
agaatttttggtgaatgtgaagaggttgggtttaacgccacgctagtggcgaggatttgtctctg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715081 |
agaatttttggtgaatgtgaagaggttgggtttaacgccacgctagtggcgaggatttgtctctg |
44715017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University