View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20099_low_32 (Length: 265)
Name: NF20099_low_32
Description: NF20099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20099_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 42925474 - 42925706
Alignment:
| Q |
18 |
aatgcaatcttgtgaaaccacagacgacaaacccaaaatgaaatcatcaacattcaatcacccaagaaagggctcaccagctccgaaacccacccaacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42925474 |
aatgcaatcttgtgaaaccacagacgacaaacccaaaatgaaatcatcaacattcaatcacccaagaaagggctcaccagctccgaaacccacccaacat |
42925573 |
T |
 |
| Q |
118 |
ccggatcctcaacaacttcacccgaacctgaacctgaacccatacccgatccattaaaagagttctctttgctcagtttctcaaacatcttcacccttat |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42925574 |
ccggatcctcaacaacttcacccaaacctgaacctgaacccatgcccgatccattaaaagagttctctttgctcagtttctcaaacatcttcacccttat |
42925673 |
T |
 |
| Q |
218 |
atctcttccagattccaccctctccatcacagg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42925674 |
atctcttccagattccaccctctccatcacagg |
42925706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University