View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20100_high_6 (Length: 288)
Name: NF20100_high_6
Description: NF20100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20100_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 24709951 - 24709679
Alignment:
| Q |
1 |
attgacatgtgccatcattgcgtgcttgttcttctgtaacttgaaaatcttctatacctgtgcatcaaagcatgtgggatccttttgtctaattcatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
24709951 |
attgacatgtgccatcattgcgtggatgttcttctataacttgaaaatcttctataccagtgcatcaaagcatgtgggatcctgttgtctaatttatatg |
24709852 |
T |
|
| Q |
101 |
tgaggcctccaattgtgattgtgcagccataaaaagcacagagatgagaattaaaacgaagtgtagagggtacaaatgtggccttcacaataaatggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24709851 |
tgaggcctccaattgtgattgtgcagccataaaaagcacagagatgagaattaaaacgaagtgtagagggtacaaatgtggccttcacaataaatggtgt |
24709752 |
T |
|
| Q |
201 |
tgttgcaatatac-caataggaagcataaccgattagcatgaccaattactttggacgattccaggttccaac |
272 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
24709751 |
tgttgcaatatacagaataggaagcataaccgattagcatggccaattagtttggacgattccaggttccaac |
24709679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University