View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20100_high_8 (Length: 239)
Name: NF20100_high_8
Description: NF20100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20100_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 19 - 151
Target Start/End: Original strand, 1764443 - 1764575
Alignment:
| Q |
19 |
tgtgcaagaggcaaacagacaagagtatgactattcaataatcaatactgagatgcgtgacaacctgtaacaaaataatgaatctgagtatattattagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1764443 |
tgtgcaagaggcaaacagacaagagtatgactattcaataatcaatattgagatgcgtgacaacctgtaacaaaataatgaatctgagtatattattagc |
1764542 |
T |
 |
| Q |
119 |
agaaggatcaatttgatgtgctaaatggagata |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1764543 |
agaaggatcaatttgatgtgctaaatggagata |
1764575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 190 - 239
Target Start/End: Original strand, 1764614 - 1764663
Alignment:
| Q |
190 |
agaggatataatattttgagaaacccactagctaataacactgatttaac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1764614 |
agaggatataatattttgagaaacccactagctaataacactgatttaac |
1764663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University