View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20100_high_9 (Length: 239)
Name: NF20100_high_9
Description: NF20100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20100_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 84 - 221
Target Start/End: Original strand, 35294593 - 35294730
Alignment:
| Q |
84 |
ctcccaagttatatttatgcattcttctattatttttctgtttatttgttcaatgtacgttcggatactagttatcgattcgtgcaggatcacgaaatat |
183 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294593 |
ctcccaagttttatttatgcattcttctattatttttctgtttatttgttcaatgtacgttcggatactagttatcgattcgtgcaggatcacgaaatat |
35294692 |
T |
 |
| Q |
184 |
atatgttcatgaaggatcaagattcatgaccacattgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294693 |
atatgttcatgaaggatcaagattcatgaccacattgt |
35294730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University