View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20101_high_10 (Length: 239)
Name: NF20101_high_10
Description: NF20101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20101_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 1747491 - 1747721
Alignment:
| Q |
1 |
tctttttgtctgactagtttcattgcacgagatgcataaagatttgatgattagtggaccgtggaattcgggtgagttaactttgtttagatggtagcag |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1747491 |
tctttttgtctggctagtttcattgcacgagatgcataaagatttgatgattagtggaccgtagaattcgggtgagttaactttgtttagatggtagcag |
1747590 |
T |
|
| Q |
101 |
ctagcaatcaccgatatttatgcaaataagatcaataagtcatcctatttgcctcaattttgacaccaatgttacaataaattcaaccatgaatttggat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1747591 |
ctagcaatcaccgatatttatgcaaataatatcaagaagtcatcctatttgcctcaattttgacaccaatgatacaataaattcaaccatgaatttggat |
1747690 |
T |
|
| Q |
201 |
gcaaattatggttacattcaccatatttttc |
231 |
Q |
| |
|
|| |||| |||||||||||||||| |||||| |
|
|
| T |
1747691 |
gcgaattgtggttacattcaccatttttttc |
1747721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University