View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20101_high_12 (Length: 225)
Name: NF20101_high_12
Description: NF20101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20101_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 45794267 - 45794056
Alignment:
| Q |
1 |
tcgggcaagttcctaacgaccctaatccttacaaattacaacaaacccttgggttttggctactatacagaagcatgcaattgcttatttcaaatagaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794267 |
tcgggcaagttcctaacgaccctaatccttacaaattacaacaaacccttgggttttggctactatacagaagcatgcaattgcttatttcaaatagaac |
45794168 |
T |
 |
| Q |
101 |
gttaaacctttctaacactttgttatccaacgaaacagaaatcgaccaagtagattaatatattacaacaaccacaaactgaaagcgggagtttacaaaa |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794167 |
gataaacctttctaacactttgttatccaacgaaacggaaatcgaccaagtagattagtatattacaacaaccacaaactgaaagcgggagtttacaaaa |
45794068 |
T |
 |
| Q |
201 |
tagtcaaatttc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45794067 |
tagtcaaatttc |
45794056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University