View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20101_low_15 (Length: 208)
Name: NF20101_low_15
Description: NF20101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20101_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 14 - 120
Target Start/End: Complemental strand, 10650752 - 10650645
Alignment:
| Q |
14 |
cttttctcatgcactctgacaattttaagatatgcttagcataacttttcttgaccatgctccttaa-gtacataacaagctcgtgaaacatttagggtg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
10650752 |
cttttctcatgcactctgacaattttaagatatgcttagcataacttttcttgactatgctcctcaaggtacataacaagctcgtgaaacatttagggtg |
10650653 |
T |
 |
| Q |
113 |
tgtttgga |
120 |
Q |
| |
|
|||||||| |
|
|
| T |
10650652 |
tgtttgga |
10650645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 10648977 - 10648916
Alignment:
| Q |
119 |
gagatgttattgattagttacacataaatttattctcatcttcatggtattttttcacactc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10648977 |
gagatgttattgattagttacacataaatttattctcatcttcatagtattttttcacactc |
10648916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 164
Target Start/End: Complemental strand, 38528895 - 38528867
Alignment:
| Q |
136 |
ttacacataaatttattctcatcttcatg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38528895 |
ttacacataaatttattctcatcttcatg |
38528867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 18094130 - 18094162
Alignment:
| Q |
133 |
tagttacacataaatttattctcatcttcatgg |
165 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
18094130 |
tagttacacatgaatttattctcatcttcatgg |
18094162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 163
Target Start/End: Original strand, 37296579 - 37296611
Alignment:
| Q |
131 |
attagttacacataaatttattctcatcttcat |
163 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
37296579 |
attagttacacatgaatttattctcatcttcat |
37296611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 37851735 - 37851767
Alignment:
| Q |
133 |
tagttacacataaatttattctcatcttcatgg |
165 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
37851735 |
tagttacacatgaatttattctcatcttcatgg |
37851767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University