View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20102_high_10 (Length: 286)
Name: NF20102_high_10
Description: NF20102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20102_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 33032478 - 33032214
Alignment:
| Q |
18 |
tcttttaggtcattagggataaaagcacactcttcaatgcactatggtttctcaccaacaccaattaggcctcatcat---gaggtgagaaataatatga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33032478 |
tcttttaggtcattagggataaaagcacactcttcaatgcactatggtttctcaccaacaacaattaggcctcatcatcatgaggtgagaaataatatga |
33032379 |
T |
 |
| Q |
115 |
gattcgagcaacaaggttgcgtcggatttccaatattcttggaagacgaggagtcaaagttgatgtggccaggtagttttcgacaagaatctggggcggg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33032378 |
gattcgagcaacaaggttgcgtcggatttccaatattcttggaagacgaggagtcaaagttgatgtggccaggtagttttcgacaagaatccggggcggg |
33032279 |
T |
 |
| Q |
215 |
tggtgcacaacagaatttcatactcactgaggtgaatccttgtgtagacatagaataatctaccc |
279 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33032278 |
tggtgctcaacagaatttcatactcactgaggtgaatccttgtgtagacatagaaaaatctaccc |
33032214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University