View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20102_low_13 (Length: 218)
Name: NF20102_low_13
Description: NF20102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20102_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 39 - 199
Target Start/End: Original strand, 36960462 - 36960622
Alignment:
| Q |
39 |
tgaaagatgcaagtaaaataaatcatcataatacatcagtgccacaaataattttaagtctttaatatgtattcctctnnnnnnnngtcttcaatatgta |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36960462 |
tgaaagatgcaagtaaaataaatcatcataatacatcagtgccacaaataattttaagtctttaatatgtattcctctaaaaaaaagtcttcaatatgta |
36960561 |
T |
|
| Q |
139 |
ttgattcaatgcttttttcttttaccttcaacatcaaatgtaaaaactaagggcacaacac |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36960562 |
ttgatccaatgcttttttcttttaccttcaacatcaaatgtaaaaactaagggcgcaacac |
36960622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University