View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20104_low_7 (Length: 201)
Name: NF20104_low_7
Description: NF20104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20104_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 26310224 - 26310055
Alignment:
| Q |
12 |
agattatacttagggtttgatcaggatttcttaaagttatatccctttgatgatgagaggagaaagagtctgcaaagaaagagcgggagccattagggaa |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26310224 |
agattaaacttagggtttgatcaggatttcttaaagttatatccctttgatgatgagaggagaaag--tctgcaaagaaagagcgggagccattagggaa |
26310127 |
T |
 |
| Q |
112 |
ggttgagattacttgttaaacacgttcagtgttggtgggtggccagatggagtggcacatgatggcccatag |
183 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||| |||||||||| |
|
|
| T |
26310126 |
ggttgagattacttgttgaacacgttcagtgttggtggatggctagatggagtggcacatgttggcccatag |
26310055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 25783075 - 25782904
Alignment:
| Q |
12 |
agattatacttagggtttgatcaggatttcttaaagttatatccctttgatgatgagaggagaaagagtctgcaaagaaagagcgggagccattagggaa |
111 |
Q |
| |
|
|||||| ||||||||||| ||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
25783075 |
agattaaacttagggtttcgtcatgatttgttaaagtcatatccctttgatgatgagaggagaaagagtctgcaaagaaagagcggaagccatttgggaa |
25782976 |
T |
 |
| Q |
112 |
ggttgagattacttgttaaacacgttcagtgttggtgggtggccagatggagtggcacatgatggcccatag |
183 |
Q |
| |
|
| ||||||||||||| | |||||||||||||||||||| ||||| |||||||||||||| | |||||||| |
|
|
| T |
25782975 |
gtttgagattacttgctgaacacgttcagtgttggtggaaggccaagtggagtggcacatgttagcccatag |
25782904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University