View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20104_low_7 (Length: 201)

Name: NF20104_low_7
Description: NF20104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20104_low_7
NF20104_low_7
[»] chr1 (2 HSPs)
chr1 (12-183)||(26310055-26310224)
chr1 (12-183)||(25782904-25783075)


Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 26310224 - 26310055
Alignment:
12 agattatacttagggtttgatcaggatttcttaaagttatatccctttgatgatgagaggagaaagagtctgcaaagaaagagcgggagccattagggaa 111  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
26310224 agattaaacttagggtttgatcaggatttcttaaagttatatccctttgatgatgagaggagaaag--tctgcaaagaaagagcgggagccattagggaa 26310127  T
112 ggttgagattacttgttaaacacgttcagtgttggtgggtggccagatggagtggcacatgatggcccatag 183  Q
    ||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||| ||||||||||    
26310126 ggttgagattacttgttgaacacgttcagtgttggtggatggctagatggagtggcacatgttggcccatag 26310055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 25783075 - 25782904
Alignment:
12 agattatacttagggtttgatcaggatttcttaaagttatatccctttgatgatgagaggagaaagagtctgcaaagaaagagcgggagccattagggaa 111  Q
    |||||| |||||||||||  ||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||    
25783075 agattaaacttagggtttcgtcatgatttgttaaagtcatatccctttgatgatgagaggagaaagagtctgcaaagaaagagcggaagccatttgggaa 25782976  T
112 ggttgagattacttgttaaacacgttcagtgttggtgggtggccagatggagtggcacatgatggcccatag 183  Q
    | ||||||||||||| | ||||||||||||||||||||  |||||  |||||||||||||| | ||||||||    
25782975 gtttgagattacttgctgaacacgttcagtgttggtggaaggccaagtggagtggcacatgttagcccatag 25782904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University