View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20105_high_13 (Length: 263)
Name: NF20105_high_13
Description: NF20105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20105_high_13 |
 |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 24 - 101
Target Start/End: Complemental strand, 352107 - 352030
Alignment:
| Q |
24 |
gtgtaaaagtctatggattccttcacatctctgcacagccttgaaatatggtttagtgccattaatggtgtttggtta |
101 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
352107 |
gtgtagaagtctatggattccttcacatctctgcatagccttgaaatatggtttagtgccattaatggtgtttggtta |
352030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 351941 - 351882
Alignment:
| Q |
190 |
gcattgctattctattacggagtataatttcttgttattcatataa-aaaagggtatatt |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
351941 |
gcattgctattctattgcggagtataatttcttgttattcatataaaaaaagggtatatt |
351882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University