View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20105_low_17 (Length: 304)
Name: NF20105_low_17
Description: NF20105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20105_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 287
Target Start/End: Complemental strand, 38142640 - 38142363
Alignment:
| Q |
11 |
agattatactcgaggcgaaccaaggtaannnnnnngtttatttatgttttcacatttatctatctgacaacctaaaatgtttaaatcatctaattaa-tc |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
38142640 |
agattacactcgaggcgaaccaaggtaatttttttgtttatttatgttttcacatttatctatccgacaacctaaaatgtttaaatcatctaattaaatc |
38142541 |
T |
|
| Q |
110 |
acttatagattgattatgtcaattcataattgattaattaattagacacttgagtctaatgatgcagattattaaatatgtttaaaccaagtaacattat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38142540 |
acttatagattgattatgtcaattcataattgattaattaattagacacttgagtctaatgatgcagattattaaatatgtttaaaccaagtaacattat |
38142441 |
T |
|
| Q |
210 |
gttttatactcatgctgatcaggttgtctcaactgatcctaatccagaatgggatgagaggtttacatacatggtcct |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38142440 |
gttttatactcatgctgatcaggttgtctcaactggtcctaatccagaatgggatgagaggtttacatacatggtcct |
38142363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 150
Target Start/End: Original strand, 25189444 - 25189476
Alignment:
| Q |
118 |
attgattatgtcaattcataattgattaattaa |
150 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
25189444 |
attgattatttcaattcataattgattaattaa |
25189476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University