View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20105_low_27 (Length: 244)
Name: NF20105_low_27
Description: NF20105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20105_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 95 - 226
Target Start/End: Complemental strand, 30146485 - 30146354
Alignment:
| Q |
95 |
tgaaatccaccatgagacacaggagaggcataaatcattaagaaaataaattaatggaactctatgatcagctatggttcatatgggttggatgagtggg |
194 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30146485 |
tgaaatccaccatgaaacacaggagaggcataaatcattaagaaaataaattaatggaactctatgatcagctatggttcatatgggttggatgagtggg |
30146386 |
T |
 |
| Q |
195 |
aagtcaaccaaaagggttactttccacctata |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30146385 |
aagtcaaccaaaagggttactttccacctata |
30146354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 30146540 - 30146483
Alignment:
| Q |
1 |
atttcaaggaggaaaaaatattaaaactaaaacctcaagattttataaagtatcatga |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30146540 |
atttcaaggaggaaaaaatattaaaactaaaacctcaagattttataaagtatcatga |
30146483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University