View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20106_high_2 (Length: 313)
Name: NF20106_high_2
Description: NF20106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20106_high_2 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 85 - 313
Target Start/End: Original strand, 34327031 - 34327259
Alignment:
| Q |
85 |
tgaattagttaaatgatttcttggagcaataacaggttgtcccatgttgatgtcaacaagttcaggcctgcatgcttcatcaccatgatttccctctcaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34327031 |
tgaattagttaaatgatttcttggagcaataacaggttgtcccatgttgatgtcaacaagttcaggcctgcatgcttcatcaccatgatttccctctcaa |
34327130 |
T |
 |
| Q |
185 |
aggcatacaccctttcggtatcgtgtttttgggcaatgggaccttaccttacaaacaatgacatatttgtagggaatgtcctatgtatatatctttccaa |
284 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34327131 |
agccatacaccctttcggtatcgtgtttttgggcaatgggaccttaccttacaaacaatgacatatttgtagggaatgtcctatgtatatatctttccaa |
34327230 |
T |
 |
| Q |
285 |
tgtcatgttacttaacaaataattcatca |
313 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34327231 |
tgtcatgttacttaacaaataattcatca |
34327259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University