View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20106_low_3 (Length: 313)

Name: NF20106_low_3
Description: NF20106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20106_low_3
NF20106_low_3
[»] chr3 (1 HSPs)
chr3 (85-313)||(34327031-34327259)


Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 85 - 313
Target Start/End: Original strand, 34327031 - 34327259
Alignment:
85 tgaattagttaaatgatttcttggagcaataacaggttgtcccatgttgatgtcaacaagttcaggcctgcatgcttcatcaccatgatttccctctcaa 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34327031 tgaattagttaaatgatttcttggagcaataacaggttgtcccatgttgatgtcaacaagttcaggcctgcatgcttcatcaccatgatttccctctcaa 34327130  T
185 aggcatacaccctttcggtatcgtgtttttgggcaatgggaccttaccttacaaacaatgacatatttgtagggaatgtcctatgtatatatctttccaa 284  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34327131 agccatacaccctttcggtatcgtgtttttgggcaatgggaccttaccttacaaacaatgacatatttgtagggaatgtcctatgtatatatctttccaa 34327230  T
285 tgtcatgttacttaacaaataattcatca 313  Q
    |||||||||||||||||||||||||||||    
34327231 tgtcatgttacttaacaaataattcatca 34327259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University