View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20106_low_4 (Length: 275)
Name: NF20106_low_4
Description: NF20106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20106_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 33594237 - 33594399
Alignment:
| Q |
1 |
tttaagatttgtatatgatctaagacatgtactatttttatttgattgatgatgatagaaggggtgtagatttaaggcatgggaatgtgaatgattggat |
100 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33594237 |
tttaagatttgtat--gatctgagacttgtactatttttatttgattgatgat---agtaggggtgtcgatttaaggcatgggaatgtgaatgattggat |
33594331 |
T |
|
| Q |
101 |
atgaaattaatggaaattttgaaacagctctggtgacttgatgggtcttaatttcttcatcctcatgt |
168 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33594332 |
atgaaattaatggaaattgtgaaacagctctggtgacttgatgggtcttaatttcttcatcatcatgt |
33594399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 166 - 273
Target Start/End: Original strand, 33596525 - 33596632
Alignment:
| Q |
166 |
tgtggactaccttatgccaacaccaatttatctgtaattccatcggttgtgggatattattgaatctttgctatattactctacatgtggatgaaagtga |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33596525 |
tgtggactaccttatgccaacaccaatttatctgtaattccatcggttgtgggatattattgaatttttgctatattactctacatgtggatgaaagtga |
33596624 |
T |
|
| Q |
266 |
tgatgtcc |
273 |
Q |
| |
|
|||||||| |
|
|
| T |
33596625 |
tgatgtcc |
33596632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University