View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20106_low_6 (Length: 250)
Name: NF20106_low_6
Description: NF20106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20106_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 26310496 - 26310667
Alignment:
| Q |
19 |
acaaccaaattcgataacttccttatgcttgattttactttattataatgat-tttatttgttaccgtaattctcttcaatttgtttttccatgtctaaa |
117 |
Q |
| |
|
||||||||||||||||| || ||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26310496 |
acaaccaaattcgataagtttcttgtgcttgattttactttattataatgatatttatttgttaccgtaattctcttcaatttgtctttccatgtctaaa |
26310595 |
T |
|
| Q |
118 |
ataagaaaaatgattcata--gtggttcttgtatcaccactatataacaaggatgtgatcaaatatccggttgg |
189 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
26310596 |
ataagaaaaatgattcatagtgtggttcatgtatcaccactagataacaagg--gtgatcaaatatccggttgg |
26310667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 26310894 - 26310947
Alignment:
| Q |
186 |
ttggatattggatatgatgtgtttgcttacgggtcttgtctcgttgaccttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26310894 |
ttggatattggatatgatgtgtttgcttacgggtcttgtctcgttgaccttcat |
26310947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 21347291 - 21347389
Alignment:
| Q |
18 |
gacaaccaaattcgataacttccttatgcttgattttactttattataatgat-tttatttgttaccgtaattctcttcaatttgtttttccatgtctaa |
116 |
Q |
| |
|
|||||||||||| ||||| || ||| || ||||||||||||||||| || || ||||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
21347291 |
gacaaccaaatttgataaatttcttgtgtttgattttactttatta--atcatatttatttgttaccataattatctttaatttgtttttccatgtctaa |
21347388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University