View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20107_low_20 (Length: 381)
Name: NF20107_low_20
Description: NF20107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20107_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 66 - 364
Target Start/End: Complemental strand, 34417821 - 34417516
Alignment:
| Q |
66 |
ccgtcccctaacataaattaattttggcatacatgcatatttccagcaagatgtaaaattgtgtggctcacaaagatacaaaagaataaagcttaaacaa |
165 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34417821 |
ccgtccccaaacataaattaattttggcatacatgcatctttccagcaagatgtaaaattgtgtggctcacaaagatacaaaagaataaagctgaaacaa |
34417722 |
T |
 |
| Q |
166 |
aaggttagaggttagagattcacaagatttgccagtagcttaatatctttgctgatggatttgatatcctaactcagattc-------aagatgctgaga |
258 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34417721 |
aaggttacaggttagagattcacaagatttgccagtagcttaatatctttgctcatggatttgatatcctaactcagattcaagaatcaagatgctgaga |
34417622 |
T |
 |
| Q |
259 |
aactattattaaatccatatgcatgcatagtccattacaaaggcagtacaagtttgtacgtggaagttggaagatgctataatatggattcaattatgat |
358 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34417621 |
aactattattaaatccatatgcatgcatactccattacaaaggcagtacaagtttgtacgtggaagttggaagatgctatattatggattcaattatgat |
34417522 |
T |
 |
| Q |
359 |
acttgt |
364 |
Q |
| |
|
|||||| |
|
|
| T |
34417521 |
acttgt |
34417516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 27 - 55
Target Start/End: Complemental strand, 29830445 - 29830417
Alignment:
| Q |
27 |
agattttcaaccctacatctttagttgac |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29830445 |
agattttcaaccctacatctttagttgac |
29830417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University