View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20107_low_29 (Length: 322)
Name: NF20107_low_29
Description: NF20107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20107_low_29 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 182 - 322
Target Start/End: Original strand, 13870096 - 13870236
Alignment:
| Q |
182 |
cctttgtaggagccaggcttttccaaacggacccaaacaccctttctttggtaccacacaattcctctctcggtatcaacaaattctccaagatcttgta |
281 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13870096 |
cctttgtagaagccaggcttttccacacggacccaaacaccctttctttggtaccacacaattcctctctcggtatcaacaaattctccaagatcttgta |
13870195 |
T |
|
| Q |
282 |
ggttgaactcaccataaaactacctgtctcctccgacttcc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13870196 |
ggttgaactcaccataaaactacctgtctcctccgacttcc |
13870236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 43 - 185
Target Start/End: Original strand, 13869898 - 13870037
Alignment:
| Q |
43 |
taatatgtaaccaaccaagcaccttaattagaccataccttgaaggcaaactgacaatgaaggaaaatatgtgaggagatttcagccctcagattgcaga |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13869898 |
taatatgtaaccaaccaagcacctta----gaccataccttgaaggcaaactgacaatgaaggaaaatatgtgaggagatttcagccctcagattgcaga |
13869993 |
T |
|
| Q |
143 |
aaacacaattcactgagtcatctaaaggc-aaactctcctcctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13869994 |
aaacacaattcactgagtcatctaaaggcaaaactctcctcctt |
13870037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University