View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20107_low_31 (Length: 305)
Name: NF20107_low_31
Description: NF20107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20107_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 290
Target Start/End: Original strand, 36728012 - 36728291
Alignment:
| Q |
16 |
atggtggaattcaggttctactgaccaagagttttcaaacatgaaatatttttcctaaaaatatggaacattcttcggctcacaagagagcaataaagga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728012 |
atggtggaattcaggttctactgaccaagagttttcaaacatgaaatatttttcctaaaaatatggaacattcttcggctcacaagagagcaataaagga |
36728111 |
T |
 |
| Q |
116 |
taatgataggaagcagtaatagttaagcactctgaaaacatactacaccagttgtttatagtcattgtatggtcgagttacccctccatattca---aat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36728112 |
taatgataggaagcagtaatagttaagcactctgaaaacatactacaccagttgtttatagtcattgtatggtcgagttacccctccatattcaaataat |
36728211 |
T |
 |
| Q |
213 |
caatcaaacccgcatttgttaatgcctcacggaaacc---attgatgagcttattttgatctatccgtcctgcctcttttt |
290 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
36728212 |
caatcaaacccacatttgttaatgcctcacggaaaccaatattgatgagctta-tttgatctatccgccctgccccttttt |
36728291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University