View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20107_low_33 (Length: 298)
Name: NF20107_low_33
Description: NF20107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20107_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 21 - 288
Target Start/End: Complemental strand, 5562695 - 5562425
Alignment:
| Q |
21 |
agaggtgacattggctcgttttgggacaagagtaggacactgaccttgaaacagagtacttgctttttccataaatcggg-atgcttatgggccacgaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5562695 |
agaggtgacattggctcgttttgggacaagagtaggacactgaccttgaaacagagtacttactttttccataaatcggggatgcttatgggccacgaaa |
5562596 |
T |
 |
| Q |
120 |
tacctaattttaggcctgccgaggataataaaaagttcacttattatccacgaccatacccaatgtgatcacgtgatgaatgtgtgtg----tctttgac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
5562595 |
tacctaattttaggcctgccgaggataataaa--gttcacttattatccacgaccatacccaatgtgatcacgtgatgaatgtgggtgggtgtctttgac |
5562498 |
T |
 |
| Q |
216 |
ccatgctgacttgcctttcaaactcaaatttcaaagtttcaaactatactgcccaatggccacgtgatctgtg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5562497 |
ccatgctgacttgcctttcaaactcaaatttcaaagtttcaaactatactgcccaatggctacgtgatctgtg |
5562425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University