View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20107_low_36 (Length: 286)
Name: NF20107_low_36
Description: NF20107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20107_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 43 - 276
Target Start/End: Complemental strand, 3916394 - 3916161
Alignment:
| Q |
43 |
cttcaagagtaacttatatacactatggcaaaacccatcactggttcacttgttttagttctccttgttacggcgattctgaacggacacaccgaagctg |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
3916394 |
cttcaagagtaacttatatacactatggcaaaaaccatcactggttcacttgttttagttctccttgttacggcgattctgaacggccacatcgaagctg |
3916295 |
T |
 |
| Q |
143 |
ccggtagaggagctgaaccaccaaaggatggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgctt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3916294 |
ccggtagaggagctgaaccaccaaaggatggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgctt |
3916195 |
T |
 |
| Q |
243 |
gttttggtataaactttgtttgttttggcctttg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3916194 |
gttttggtataaactttgtttgttttggcctttg |
3916161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 125
Target Start/End: Original strand, 5398543 - 5398604
Alignment:
| Q |
61 |
tacactatggcaaaacccatcactggttcacttgttttagttctccttgttacggcgattctgaa |
125 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
5398543 |
tacactatggcaaaatcca---ctgcttcacttgttttggttctccttgttgcggcgattttgaa |
5398604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University