View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20107_low_50 (Length: 228)
Name: NF20107_low_50
Description: NF20107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20107_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 43087886 - 43088027
Alignment:
| Q |
1 |
aatcgttcaaaataaaagcaaagaggtaaacatcattcttcgtgtaaaattcattttttatggttttaagttataacaaactttnnnnnnnttgtaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
43087886 |
aatcgttcaaaataaaagcaaagaggtaaacatcattcttcgtgtaaaattcattttttatggttataagttataacaaactttaaaaaaattgtaaatt |
43087985 |
T |
 |
| Q |
101 |
tagaaagtcatagatagttatgagtgttttatgtaaagaacc |
142 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43087986 |
tagaaagtcatagatagttatgaatgttttatgtaaagaacc |
43088027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 43088066 - 43088099
Alignment:
| Q |
178 |
atgaaggatttaaaattgagtttttgaagtttct |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
43088066 |
atgaagaatttaaaattgagtttttgaagtttct |
43088099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University