View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20108_high_11 (Length: 299)
Name: NF20108_high_11
Description: NF20108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20108_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 15 - 291
Target Start/End: Complemental strand, 35110174 - 35109898
Alignment:
| Q |
15 |
ggatgatatggttcgagttaaagggtggactaatgtctccgtgagtttaaatccgtcgataacaatgcataacatatataagatatgtgattcgaactcc |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| ||||||||||| ||| |||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
35110174 |
ggatgatatggttctcgttaaagggtggactagtgttcccgtgagtttagatcagtcgataacaatgcataatatatgtaagatatgtgattcgaactcc |
35110075 |
T |
 |
| Q |
115 |
tgacacacnnnnnnnnnnggatggactagtactcaccaaattgatttctaatccctctatcaaaaaatattagtaaccgatacgtataaagatactaacc |
214 |
Q |
| |
|
||||| | |||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35110074 |
tgacaaaaaaaaaaaaaaagatggactagtattcaccaaattgatttgcaatccatctatcaaaaaatattagtaactaatgcgtataaagatactaacc |
35109975 |
T |
 |
| Q |
215 |
tatttggattgacctaatgatgttggtttgaaattttggagcatgctctcctcaaaatcttaaatttgattcttctc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35109974 |
tatttggattgacctaatgatgttggtttgaaattttggagcatgttctcctcaaaatcttaaatttgattcttctc |
35109898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Complemental strand, 18718217 - 18718184
Alignment:
| Q |
214 |
ctatttggattgacctaatgatgttggtttgaaa |
247 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
18718217 |
ctatttgggttgacctaatgatgttggtttgaaa |
18718184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University