View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20108_high_14 (Length: 281)
Name: NF20108_high_14
Description: NF20108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20108_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 8 - 265
Target Start/End: Complemental strand, 10690517 - 10690257
Alignment:
| Q |
8 |
agattattcttgagaccaattctctgcatggaaaaagtagcagcacctccaagttctcatggaatttcttccatggttaaaagaaagacaccatcagaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10690517 |
agattattcttgagaccaattctctgcatggaaaaagtagcagcacctccaagttctcatggaatttcttccatggttaaaagaaagacaccatcagaac |
10690418 |
T |
 |
| Q |
108 |
ttaggggagagcagttgaagcgggaaaatgttgaagacctcactgatgatgatg---atgaggtttctccctctgctggttccgcgaaagatacacaact |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10690417 |
ttaggggagagcagttgaagcgggaaagtgttgaagacctcactgatgatgatgatgatgaggtttctccctctgctggttccgcgaaagatacacaact |
10690318 |
T |
 |
| Q |
205 |
aattggtgaagtattttctgcgaaaaagtccatgtttagaattgtatctaaggagcaaact |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10690317 |
aattggtgaagtattttctgcgaaaaagtccatgtttagaattgtatctaaggagcaaact |
10690257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University