View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20108_high_8 (Length: 337)
Name: NF20108_high_8
Description: NF20108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20108_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 78 - 320
Target Start/End: Complemental strand, 1004717 - 1004468
Alignment:
| Q |
78 |
ggtaaggagtcccttttggtccaataattacatccctcaacagattcatctttcatttatatgctcggacaaatatggaatctgacaaagataaaagagt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004717 |
ggtaaggagtcccttttggtccaataattacagccctcaacagattcatctttgatttatatgctcggacaaatatggaatctgacaaagataaaagagt |
1004618 |
T |
|
| Q |
178 |
agaaaa-------gagattgagcaaaattccataataacaatactgaattgaacacaaagcaaacccacccggcaaatccttctccaaaatttcccagtc |
270 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004617 |
agaaaaacatgacgagattgagcaaaattccataataacaatactgaattgaacacaaagcaaacccacccggcaaatccttctccaaaatttcccagtc |
1004518 |
T |
|
| Q |
271 |
ttcctggattgcatccgaccaattatttggatgctgttaaggaaatgagt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004517 |
ttcctggattgcatccgaccaattatttggatgctgttaaggaaatgagt |
1004468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 1004789 - 1004745
Alignment:
| Q |
16 |
ctcaacgacataccgggggtacaatgggatagttactaggaaagt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1004789 |
ctcaacgacataccgggggtacaatgggatagttactagggaagt |
1004745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 221 - 316
Target Start/End: Complemental strand, 52472840 - 52472745
Alignment:
| Q |
221 |
gaacacaaagcaaacccacccggcaaatccttctccaaaatttcccagtcttcctggattgcatccgaccaattatttggatgctgttaaggaaat |
316 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||||| | ||| |||| || |||| | | | |||||| | ||||||||||| ||||||| |
|
|
| T |
52472840 |
gaacacaaaaccaactcacccggcaaatccttctccaaaatcttccattctttcttgatttctttagcccaattctctggatgctgttcaggaaat |
52472745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University