View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20108_low_24 (Length: 211)
Name: NF20108_low_24
Description: NF20108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20108_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 22776990 - 22776797
Alignment:
| Q |
18 |
aagatgaagaagaattgtctattgatgatttatctcaaagacaagacacagaaatcaaacacattgtttttgggatagcggcttcatcaaatttgtggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22776990 |
aagatgaagaagaattgtctattgatgatttatctcaaagacaagacacagagatcaaacacattgtttttgggatagcggcttcatcaaatttgtggaa |
22776891 |
T |
 |
| Q |
118 |
cataagaaaggaatacattaaggtatggtggaaacctaatgaaacaagaggggtggtgtggatggatcaaagagtgaagacacgtgatgatgaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22776890 |
cataagaaaggaatacattaaggtatggtggaaacataatgaaacaagaggggtggtgtggatggatcaaagagtgaagacacgtgatgatgaa |
22776797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 51 - 194
Target Start/End: Complemental strand, 40945571 - 40945428
Alignment:
| Q |
51 |
ctcaaagacaagacacagaaatcaaacacattgtttttgggatagcggcttcatcaaatttgtggaacataagaaaggaatacattaaggtatggtggaa |
150 |
Q |
| |
|
||||||||||||| || || | ||||||||||||||||||||||| |||||||||||||| ||||| | |||||| |||||||| || ||||||||| |
|
|
| T |
40945571 |
ctcaaagacaagatactgagctgaaacacattgtttttgggatagctgcttcatcaaatttatggaatacaagaaaagaatacatcaaaatatggtggag |
40945472 |
T |
 |
| Q |
151 |
acctaatgaaacaagaggggtggtgtggatggatcaaagagtga |
194 |
Q |
| |
|
||| || |||||||||| || || ||| | ||||||||||||| |
|
|
| T |
40945471 |
accaaaacaaacaagaggtgttgtttggttagatcaaagagtga |
40945428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University