View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2010_high_21 (Length: 240)
Name: NF2010_high_21
Description: NF2010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2010_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 32045899 - 32045678
Alignment:
| Q |
1 |
gaataaggaaaatactcttcatataagaatgaatagattgtagtaccgactttatcataacttccttacccgctttagccaacgccctatccaagagttt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32045899 |
gaataaggaaaatactcttcacataagaataaatagattgtggtaccgactttatcataacttccttacccgctttagccaacgccctatccaagagttt |
32045800 |
T |
 |
| Q |
101 |
attttccttaatatcatatccctaatataagcgaaatttgtcttgttgcttctcccaatcattgaaggcaactcaaggtaagtgacaattatcaacgaca |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32045799 |
attttccttaatatcttatccctaatataagcgaaatttgtcttgttgcttctcccactcattgaaggcaactcaaggtaagtaacaattatcaacgaca |
32045700 |
T |
 |
| Q |
201 |
acatgtgacgaacaccaaaaat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32045699 |
acatgtgacgaacaccaaaaat |
32045678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 61
Target Start/End: Complemental strand, 33071234 - 33071176
Alignment:
| Q |
3 |
ataaggaaaatactcttcatataagaatgaatagattgtagtaccgactttatcataac |
61 |
Q |
| |
|
|||||||||| || | | ||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
33071234 |
ataaggaaaacacacatgatataagaaggaatatattgtagaaccgactttatcataac |
33071176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University