View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2010_low_18 (Length: 258)
Name: NF2010_low_18
Description: NF2010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2010_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 10604142 - 10604368
Alignment:
| Q |
12 |
atcatcatcgttgtttgctagttgtaattctccattactatgtaattgtttatttatttgatcttatactaaatgaaatggtcactggataaattaaaga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604142 |
atcatcatcgttgtttgctagttgtaattctccattactatgtaattgtttatttatttgatcttatactaaatgaaatggtcactggataaattaaaga |
10604241 |
T |
|
| Q |
112 |
attcttaactatgttgactttttcttcattgatgtaatggaataaaatgaggattgtaatctttttattcagcatttgaaagtgtcatcttttaggttga |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10604242 |
attcttaactatgttgactttttctccattgatgtaatggaataaaatgaggattgtaatctttttattcagcatttgaaagtgtcat-ttttaggttga |
10604340 |
T |
|
| Q |
212 |
tcatgggtgaaagaactctagtgttcct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10604341 |
tcatgggtgaaagaactctagtgttcct |
10604368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University