View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2010_low_25 (Length: 237)
Name: NF2010_low_25
Description: NF2010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2010_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 222
Target Start/End: Complemental strand, 3758549 - 3758349
Alignment:
| Q |
22 |
gttagtgataatgaaactttcataactgttgacaggttgaatttccaagtttggagacattgaagctttactcaatcaatgtacagaggatatgggatga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3758549 |
gttagtgataatgaaactttcataactgttgacaggttgaatttccaagtttggagacattgaagctttactcaatcaatgtacagaggatatgggatga |
3758450 |
T |
 |
| Q |
122 |
caaactttcagcaaattcttgctttcaaaatttgaccaatttgactgtagatggttgtgaaagtttgaaacatcttttctcattctcagtggctgaaaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3758449 |
caaactttcagcaaattcttgctttcaaaatttgaccaatttgactgtagatggttgtgaaagtttgaaacatcttttctcattctcagtggctgaaaaa |
3758350 |
T |
 |
| Q |
222 |
t |
222 |
Q |
| |
|
| |
|
|
| T |
3758349 |
t |
3758349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 28 - 184
Target Start/End: Complemental strand, 6990456 - 6990300
Alignment:
| Q |
28 |
gataatgaaactttcataactgttgacaggttgaatttccaagtttggagacattgaagctttactcaatcaatgtacagaggatatgggatgacaaact |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| | |||| || |||||| || ||||||||| |||||| |||| |
|
|
| T |
6990456 |
gataatgaaactttcataactattgacaggttgaatttccaagtttggaggcattgcaactttcctgaatcaaagtccagaggatacatgatgaccaact |
6990357 |
T |
 |
| Q |
128 |
ttcagcaaattcttgctttcaaaatttgaccaatttgactgtagatggttgtgaaag |
184 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
6990356 |
ttcagcacattcttgctttcaaaatttgaccaagttgactttagatggttgtgaaag |
6990300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University