View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20110_low_11 (Length: 253)
Name: NF20110_low_11
Description: NF20110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20110_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 38548974 - 38549168
Alignment:
| Q |
19 |
ttacttatggtagtttatccagtttcaacaaagaaacaggttgactcttccaccatggtccttaacaaagctcgacgtccatcaattgcatcctctccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38548974 |
ttacttatggtagtttatccagtttcaacaaagaaacaggttgactcttccaccatagtccttaacaaagctcgacgtccatcaattgcatcctctccaa |
38549073 |
T |
|
| Q |
119 |
atgcttcccctgcaagccttgcttctttcattctttcacaccatttttctctcctttcctttcaatcgtttcacgttggtttgtcgatgcttttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38549074 |
atgcttcccctgcaagccttgcttctttcattctttcacaccatttttctctcctttcctttcaatcgtttcacgttggtttgtcgatgcttttg |
38549168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 77 - 244
Target Start/End: Complemental strand, 7354137 - 7353975
Alignment:
| Q |
77 |
tccttaacaaagctcgacgtccatcaattgcatcctctccaaatgcttcccctgcaagccttgcttctttcattctttcacaccatttttctctcctttc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7354137 |
tccttaacaaagctcgacctccatcaattgcatcctctccaaatacttcccctgcaaaccctgcttctttcattctttcacaccatttttctctcctttc |
7354038 |
T |
|
| Q |
177 |
ctttcaatcgtttcacgttggtttgtcgatgcttttgcagcctcacctttcatcattctcctttcatc |
244 |
Q |
| |
|
|| | ||||||| ||||||||| |||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
7354037 |
gtt-----catttcacgctggtttgtcaatgcttttgcagcctcgccttccatcattttcctttcatc |
7353975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University