View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20113_low_13 (Length: 247)

Name: NF20113_low_13
Description: NF20113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20113_low_13
NF20113_low_13
[»] chr2 (1 HSPs)
chr2 (15-229)||(40954345-40954559)


Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 15 - 229
Target Start/End: Original strand, 40954345 - 40954559
Alignment:
15 cagagagcagctgagtggggtttggtgctcagaacagacgctgaaaccgggaaaccacaaggagtgggagttagaaactccggtgacgatgaacagaatg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40954345 cagagagcagctgagtggggtttggtgctcagaacagacgctgaaaccgggaaaccacaaggagtgggagttagaaactccggtgacgatgaacagaatg 40954444  T
115 gcaagttctccggcaaaaggaattccaataactccggcagagtttccggtgactcttccgacggtggtgatcctcgcgggtttccgagagtttcagagga 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40954445 gcaagttctccggcaaaaggaattccaataactccggcagagtttccggtgactcttccgacggtggtgatcctcgcgggtttccgagagtttcagagga 40954544  T
215 tttgaaagatgcttt 229  Q
    |||||||||||||||    
40954545 tttgaaagatgcttt 40954559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University