View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20113_low_4 (Length: 450)
Name: NF20113_low_4
Description: NF20113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20113_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 1e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 384776 - 384959
Alignment:
| Q |
14 |
aacctgtgtatgactgagttatgcaagtcagtgagagtgtaaatgtcaaaataatgtggcaaccgtctcaacaagggtatggctaattgagtagtat--- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
384776 |
aacctgtgtatgactgagttatgcaagtcagtgagagtgtaaatgtcaaaataatgtggcaaccgtctcaacaagggtatggctaattgagta-tatctc |
384874 |
T |
 |
| Q |
111 |
ctcctgtcttacataaaccaatgtttaggatataataactatcactgttcaactgaaagccctttaatgtgatgtaatggtaaaa |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
384875 |
ctcctgtcttacataaaccaatgattaggatataataactatcactgttcaagtgaaagccctttaatgtgatgtaattgtaaaa |
384959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 288 - 386
Target Start/End: Original strand, 385439 - 385537
Alignment:
| Q |
288 |
gtcaacgaaaagggttttcaaaattacgcttataaccctctcagtgccaccatgtttttcaaacaaaaataattaccgaggcattctattctgtatagt |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
385439 |
gtcaacgaaaagggttttcaaaattacgcttataaccctctcagtgccaccaggtttttcaaacaaaaataattacctaggcattctattctgtatagt |
385537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University