View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_high_17 (Length: 362)
Name: NF20114_high_17
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 98 - 344
Target Start/End: Complemental strand, 1218017 - 1217771
Alignment:
| Q |
98 |
gtacatttgagagtgagagaggaaaaagagaggagattctgagtggtggaatttggcatgagaacaaaagaggaagtgctgtctttgtataccccacttg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1218017 |
gtacatttgagagtgagagaggaaaaagagaggagattctgagtggtggaatttggcatgagaacaaaagaggaagtgctgtctttgtataccccacttg |
1217918 |
T |
 |
| Q |
198 |
tgcatgaggaattattggggtttcacgtgcacatattgagaaaagaaaaacaagatgtcttgtgtttggattttggtgtaagtgggttttagagactttg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1217917 |
tgcatgaggaattattggggtttcacgtgcacatattgagaaaagaaaaacaagatgtcttgtgtttggattttggtgtaagtgggttttagagactttg |
1217818 |
T |
 |
| Q |
298 |
gatttttacatcatcttattggcctttcttaatccctcttagatatc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1217817 |
gatttttacatcatcttattggcctttcttaagccctcttagatatc |
1217771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University