View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_high_19 (Length: 328)
Name: NF20114_high_19
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 1601202 - 1601400
Alignment:
| Q |
1 |
gtctctcacggagagcagaagcaacaatgtcagcatcggttattccataacagtcgagcatgatgacctcttcaagatgcttgaagttcttaaacaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1601202 |
gtctctcacggagagcagaagcaacaatgtcagcatcggttattccataacagtcgagcatgatgacctcttcaagatgcttgaagttcttaaacaagtt |
1601301 |
T |
 |
| Q |
101 |
gaaaatcaatttgttgtatatactgataaattaaatcttaggcta-tttttttnnnnnnnnnnntcttggctctatcaaatagaaatcaaatcaaattg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1601302 |
gaaaatcaatttgttgtatatactgataaattaaatcttaagctattttttttttaaaaaaaaatcttggctctatcaaatagaaatcaaatcaaattg |
1601400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 243 - 294
Target Start/End: Original strand, 1601441 - 1601492
Alignment:
| Q |
243 |
atgatttgtccacacttccggtaactagatattagggttctctcttgtaacc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1601441 |
atgatttgtccacacttccggtaactagatattagggttctctcttgtaacc |
1601492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University