View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_high_25 (Length: 261)
Name: NF20114_high_25
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 124 - 247
Target Start/End: Original strand, 17796736 - 17796859
Alignment:
| Q |
124 |
cttcttcatagcaacggttattttttatttcgaatcttcatcatcataatttgtttctgcttttcagcatttcgattctgttatttgattttaactttct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17796736 |
cttcttcatagcaacggttattttttatttcgaatcttcatcatcataatttgtttctgcttttcagcatttcgattctgttatttgattttaactttct |
17796835 |
T |
 |
| Q |
224 |
ctgttattatcattaggattgtga |
247 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
17796836 |
ctgttattatcattaggattgtga |
17796859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 17796622 - 17796708
Alignment:
| Q |
16 |
cattaaccgcactcataaattctcatccctctcttaagtccgtatctcaatttctcactttccaatctcgttactattcaggtattc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17796622 |
cattaaccgcactcataaattctcatccctctcttaagtccgtatctcaatttctcactttccaatctcgttactattcaggtattc |
17796708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University