View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_high_29 (Length: 249)
Name: NF20114_high_29
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 4619366 - 4619169
Alignment:
| Q |
1 |
tgagagtgagagtgagatttcttatgtttcgagtgggagtgaaactttgagacacagcttgtaaagaatctcttcatgcattaactatatatactaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4619366 |
tgagagtgagagtgagatttcttatgtttcgagtgggagtgaaactttgagacacagcttgtgaagaatctcttcatgcattaactatatatactaatac |
4619267 |
T |
 |
| Q |
101 |
accccccgctcaaatttgcgagtaacgcctaaggaaaattgggtgaccaaccagaaaatttccttccaattcaaatatcataatccaaactatgggat |
198 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4619266 |
accccccactcaaatttgcgagtaacgcctaaggaaaattgggtgaccaaccagaaaatttccttccaattcaaatatcataatccaaactttgggat |
4619169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 187 - 239
Target Start/End: Complemental strand, 4619138 - 4619086
Alignment:
| Q |
187 |
aaactatgggatcacgaatatttattgaatattttttggggggttgtgtctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4619138 |
aaactatgggatcacgaatatttattgaatattttttggggggttgtgtctct |
4619086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University