View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_high_35 (Length: 202)
Name: NF20114_high_35
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 45283737 - 45283914
Alignment:
| Q |
1 |
tataccgtctactaatcataaattaccgtctatatgagtttttnnnnnnngatagatagatatgtttaaagtcaaatatggggttagtgatttagaggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45283737 |
tataccgtctactaatcataaattaccgt--atatgagtttttaa-----gatagatagatatctttaaagtcaaatatgg--ttagtgatttagaggtt |
45283827 |
T |
 |
| Q |
101 |
gtacaaaatgtgcattaaatcaatgtatatgtttccagattataagctggagattttggggttttgactttcttgagactctctctg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45283828 |
gtacaaaatgtgcattaaatcaatgtatatgtttccagattataagctggcgattttggggttttgactttcttgagactctctctg |
45283914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University