View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_10 (Length: 495)
Name: NF20114_low_10
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-110
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 11734009 - 11734215
Alignment:
| Q |
10 |
attatactgttatgtatattgaaatgttttgatttgcaggttataaaaaatgagcttgaaggagcatagatgaagatgttggtgaagatccaatccaata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11734009 |
attatactgttatgtatattgaaatgttttgatttgcaggttataaaaaatgagcttgaaggagcatagatgaagatgttggtgaagatccaatccaata |
11734108 |
T |
 |
| Q |
110 |
ttcgcttacaggatatagacatttgtcacttggatttgagttgtgtgcggtcacaattgcatgaaatcaagatatctcgatagtccgattaagataagat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11734109 |
ttcgcttacaggatatagacatttgtcacttggatttgagttgtgtgcggtcacaattgcatgcaatcaagatatctcgatagtccgattaagataagat |
11734208 |
T |
 |
| Q |
210 |
aatctag |
216 |
Q |
| |
|
||||||| |
|
|
| T |
11734209 |
aatctag |
11734215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 270 - 480
Target Start/End: Original strand, 11734269 - 11734481
Alignment:
| Q |
270 |
ttagaccgtcggattttcatctgacgaccgagatacgcttgattgctcctccgccctaatccaaatccttcacactggctattgtagtttaaatagtatg |
369 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
11734269 |
ttagaccgtcggattttgatatgacgaccgagatccgcttgattgctactccgccctaatccaaatccctcacactggctattttagtttaaacagtatg |
11734368 |
T |
 |
| Q |
370 |
gattcccaatgtttttcttttggacctcttgcatgatgtgttccttttttaatctaaa--ttttattttataaaagtaacagtggattttctgtaatatg |
467 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11734369 |
gattcccaatgttttttttttggatctcttgcatgatgtgttccttttttaatctaaattttttattttataaaagtaacagtggattttctgtaatatg |
11734468 |
T |
 |
| Q |
468 |
ttatagctatgag |
480 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11734469 |
ttatagctatgag |
11734481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University